Review



hybridization solution expresshyb hybridization solution  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa hybridization solution expresshyb hybridization solution
    Hybridization Solution Expresshyb Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 3734 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/us12606634-302-15-20
    Average 95 stars, based on 3734 article reviews
    hybridization solution expresshyb hybridization solution - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    Hybridization:

    Article Title: A heterozygous USB1 variant linked to immunodeficiency
    Article Snippet: .. In the hybridization oven, the membrane was pre-hybridized in a tube with 10 ml ExpressHyb hybridization solution (#636833; Takara) for 40 min at 40°C. ..

    Article Title: FASTKD5 processes mitochondrial pre-mRNAs at noncanonical cleavage sites
    Article Snippet: 300–500 bp long PCR products of individual mitochondrial genes were labeled with [α- 32 P]-dCTP (Revvity) using a Random Primed DNA labeling kit (Sigma). .. Hybridization was performed according to the manufacturer’s manual using ExpressHyb Hybridization Solution (Takara Bio) and the radioactive signal was detected using a Phosphorimager system. ..

    Article Title: A heterozygous USB1 variant linked to immunodeficiency.
    Article Snippet: RNA was then treated with Escherichia coli Poly(A) Polymerase (#M0276; New England Biolabs) and incubated at 37°C for 30 min. .. In the hybridization oven, the membrane was prehybridized in a tube with 10 ml ExpressHyb hybridization solution (#636833; Takara) for 40 min at 40°C. .. 4–15 μg of RNA was heated at 95°C for 3 min and resolved in 10% Tris-borate-EDTA (TBE) Urea Gel (#EC68752BOX; Thermo Fisher Scientific) in TBE running buffer (#LC6675; Thermo Fisher Scientific) at 20 V the first hour and then increased by 5–10 V to reach 40 V overnight at 4°C.

    Article Title: Method for producing an active hepatocyte growth factor (HGF)
    Article Snippet: .. In addition, it is also possible to perform for example prehybridization in Expresshyb Hybridization Solution (CLONTECH) at 55° C. for 30 minutes or more, add a labeled probe and incubate at 37-55° C. for 1 hour or more, and three washes in 2×SSC and 0.1% SDS at room temperature for 20 minutes and then one washing in 1×SSC and 0.1% SDS at 37° C. for 20 minutes. ..

    Article Title: β-amylase and method for utilization and production thereof
    Article Snippet: .. The stringent conditions are commonly known by those skilled in the art, and examples thereof include conditions of hybridization at 68° C. in a commercially available hybridization solution, ExpressHyb Hybridization Solution (Takara Bio Inc.), or conditions of hybridization at about 65° C. in the presence of 0.7 M to 1.0 M NaCl and washing at about 65° C. with a 0.1 to 2×SSC solution (1×SSC solution: 150 mM NaCl, 15 mM sodium citrate, pH 7.0), using DNA immobilized on a filter. ..

    Article Title: Brr2p-mediated unwinding of U4/U6 is promoted by a mutually exclusive intra-molecular stem loop in U4 and involves destabilization of the 5’ stem-loop of U4
    Article Snippet: The membranes were cross-linked in a UV Stratalinker 2400 (Stratagene) using the auto crosslink feature. .. Membranes were blocked using 10 ml ExpressHyb Hybridization Solution (Takara) for 30 min after which 10 μl of 10 μM Cy5-U4 labeled probes (U4-14B: 5’ AGGTATTCCAAAAATTCCCTA 3’ and ssU4: 5’ ACCATGAGGAGACGGTCTGG 3’) was added for 1 hr in a hybridization oven set to 37 °C. .. The membranes were washed at room temperature four times with 2x SSC (20x SSC is 3 M NaCl, 0.3 M sodium citrate) and 0.1% SDS for 5 min and four times with 1x SSC and 0.1% SDS for 10 min. Membranes were scanned using a Typhoon (GE healthcare) and quantitated by Image J (NIH).

    Article Title: The RNA exosome maintains cellular RNA homeostasis by controlling transcript abundance in the brain
    Article Snippet: Clarity TM Western ECL Substrate , Bio-Rad , Cat# 1705060. .. ExpressHyb Hybridization Solution , Takara Bio , Cat# 636833. .. 10% Mini-PROTEAN , Bio-Rad , Cat# 4566033.

    Article Title: Bi-allelic mutations in FASTKD5 are associated with cytochrome c oxidase deficiency and early- to late-onset Leigh syndrome.
    Article Snippet: ARTICLE Bi-allelic mutations in FASTKD5 are associated with cytochrome c oxidase deficiency and early- to late-onset Leigh syndrome

    Membrane:

    Article Title: A heterozygous USB1 variant linked to immunodeficiency
    Article Snippet: .. In the hybridization oven, the membrane was pre-hybridized in a tube with 10 ml ExpressHyb hybridization solution (#636833; Takara) for 40 min at 40°C. ..

    Article Title: A heterozygous USB1 variant linked to immunodeficiency.
    Article Snippet: RNA was then treated with Escherichia coli Poly(A) Polymerase (#M0276; New England Biolabs) and incubated at 37°C for 30 min. .. In the hybridization oven, the membrane was prehybridized in a tube with 10 ml ExpressHyb hybridization solution (#636833; Takara) for 40 min at 40°C. .. 4–15 μg of RNA was heated at 95°C for 3 min and resolved in 10% Tris-borate-EDTA (TBE) Urea Gel (#EC68752BOX; Thermo Fisher Scientific) in TBE running buffer (#LC6675; Thermo Fisher Scientific) at 20 V the first hour and then increased by 5–10 V to reach 40 V overnight at 4°C.

    Labeling:

    Article Title: Method for producing an active hepatocyte growth factor (HGF)
    Article Snippet: .. In addition, it is also possible to perform for example prehybridization in Expresshyb Hybridization Solution (CLONTECH) at 55° C. for 30 minutes or more, add a labeled probe and incubate at 37-55° C. for 1 hour or more, and three washes in 2×SSC and 0.1% SDS at room temperature for 20 minutes and then one washing in 1×SSC and 0.1% SDS at 37° C. for 20 minutes. ..

    Article Title: Brr2p-mediated unwinding of U4/U6 is promoted by a mutually exclusive intra-molecular stem loop in U4 and involves destabilization of the 5’ stem-loop of U4
    Article Snippet: The membranes were cross-linked in a UV Stratalinker 2400 (Stratagene) using the auto crosslink feature. .. Membranes were blocked using 10 ml ExpressHyb Hybridization Solution (Takara) for 30 min after which 10 μl of 10 μM Cy5-U4 labeled probes (U4-14B: 5’ AGGTATTCCAAAAATTCCCTA 3’ and ssU4: 5’ ACCATGAGGAGACGGTCTGG 3’) was added for 1 hr in a hybridization oven set to 37 °C. .. The membranes were washed at room temperature four times with 2x SSC (20x SSC is 3 M NaCl, 0.3 M sodium citrate) and 0.1% SDS for 5 min and four times with 1x SSC and 0.1% SDS for 10 min. Membranes were scanned using a Typhoon (GE healthcare) and quantitated by Image J (NIH).



    Similar Products

    95
    TaKaRa hybridization solution expresshyb hybridization solution
    Hybridization Solution Expresshyb Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/us12606634-302-15-20
    Average 95 stars, based on 1 article reviews
    hybridization solution expresshyb hybridization solution - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshybtm hybridization solution
    Expresshybtm Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/10__1016_slash_j__isci__2026__115782-470-9-12
    Average 95 stars, based on 1 article reviews
    expresshybtm hybridization solution - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshyb solution
    Expresshyb Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/bio_rxiv__64898__2026__01__26__701835-71-6-8
    Average 95 stars, based on 1 article reviews
    expresshyb solution - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshyb hybridization solution
    Expresshyb Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/pmc12952294-39-0-4
    Average 95 stars, based on 1 article reviews
    expresshyb hybridization solution - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa expresshyb hybridization solution takara bio
    Expresshyb Hybridization Solution Takara Bio, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/pm41417727-251-34-37
    Average 95 stars, based on 1 article reviews
    expresshyb hybridization solution takara bio - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa hybridization
    Hybridization, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/us12473542-122-18-31
    Average 95 stars, based on 1 article reviews
    hybridization - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa hybridization solution
    Hybridization Solution, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/us12473542-122-26-31
    Average 95 stars, based on 1 article reviews
    hybridization solution - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa hybridization oven
    Hybridization Oven, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/expresshyb+hybridization+solution/ExpressHyb+Hybridization+Solution/pmc12851572-229-2-18
    Average 95 stars, based on 1 article reviews
    hybridization oven - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results